View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_low_68 (Length: 271)
Name: NF7550_low_68
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_low_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 15 - 202
Target Start/End: Original strand, 28926163 - 28926351
Alignment:
| Q |
15 |
tatcaagtaaaatgacctcaaaatgtacttgtgctatgtaatgt-cataaatattagtaaatgttgtacagaacaannnnnnnctctcactcaattaaca |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
28926163 |
tatcaagtaaaatgacttcaaaatgtacctgtgctatgtaatgtacataaatattagtaaatgttgtacagaacaatttttttctctcactccattaaca |
28926262 |
T |
|
| Q |
114 |
gcaatctcaagaaacacaagagtaatgacaactaataaacagatagttggatataagagactctgataaaaatcacaccagctttccca |
202 |
Q |
| |
|
||||||| ||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28926263 |
gcaatctaaagaaacacgagagtaaagacaactaacaaacagatagttggatataagagactctgatacaaatcacaccagctttccca |
28926351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University