View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_low_69 (Length: 266)
Name: NF7550_low_69
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_low_69 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 152 - 250
Target Start/End: Complemental strand, 37258214 - 37258116
Alignment:
| Q |
152 |
gatgaagttgacgttggatagtggataatgatgattgtgcatatttgccactttgtactcatctaaattgtcaagttcaattgattgactttaaggata |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37258214 |
gatgaagttgacgttggatagtggataatgatgattgtgcatatttgccactttgtactcatctaaattgtcaagttcaattgattgactttaaggata |
37258116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 37258359 - 37258264
Alignment:
| Q |
1 |
ccaccacccactcatcgtcggttctaacatatcagcaatgatacagacaagacaccgattcatgagaaatgttggtgctggagaattcttaattac |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37258359 |
ccaccacccactcatcgtcggttctaacatatcagcaatgatacagacaagacaccgattcatgagaaatgttggtgctggagaattcttaattac |
37258264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University