View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_low_70 (Length: 266)
Name: NF7550_low_70
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 21 - 257
Target Start/End: Original strand, 30897545 - 30897790
Alignment:
| Q |
21 |
ggtgggtagggcaaatcaccagtgagaagatcatcactgctgaagagggccattgctattgggtgtatttcaccactagctcagagacgaattactaccg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30897545 |
ggtgggtagggcaaatcaccagtgagaagatcatcactgctgaagagggccattgctattgggtgtatttcagcactagctcagagacgaattactaccg |
30897644 |
T |
 |
| Q |
121 |
ctatgatcagatcagagttcatcatgagtggtttggtggagagtggatcttggatg---------cataattcatgattataaacattgctcttgtttta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
30897645 |
ctatgatcagatcagagttcatcatgagtggtttggtggagagtggatcttggatgcataattgtcataattcatgattataaacattggtcttgtttta |
30897744 |
T |
 |
| Q |
212 |
tgtattttgaattggttattggcaataaacttcagtctcttcattt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30897745 |
tgtattttgaattggttattggcaataaacttcagtctcttaattt |
30897790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 57
Target Start/End: Complemental strand, 5963512 - 5963476
Alignment:
| Q |
21 |
ggtgggtagggcaaatcaccagtgagaagatcatcac |
57 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
5963512 |
ggtggttagggcaaatcactagtgagaagatcatcac |
5963476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University