View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_low_80 (Length: 250)
Name: NF7550_low_80
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_low_80 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 242
Target Start/End: Original strand, 50897844 - 50898070
Alignment:
| Q |
16 |
attgaagatgttggaagttttatatccaaaagttattcattgtttgtgcaaccaaggtgaataagccaagaatttgagttctaaggtgaataaatgagga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50897844 |
attgaagatgttggaagttttatatccaaaagttattcattgtttgtgcaaccaaggtgaataagccaagaatttgagttctaaggtgaataaatgagga |
50897943 |
T |
|
| Q |
116 |
atttaagttcgaatactaacccttgtagtatgtagacgtaatacaatgttcttgtcggttgaactatgtttacatgactctattgattatgttatgttta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50897944 |
atttaagttcgaatactaacccttgtagtatgtagacgtaatacaatgttcttgtcggttgaactatgtttacatgactctattgattatgttatgttta |
50898043 |
T |
|
| Q |
216 |
catgattcttttgacttgttatcttta |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
50898044 |
catgattcttttgacttgttatcttta |
50898070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University