View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_low_87 (Length: 243)
Name: NF7550_low_87
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_low_87 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 37258625 - 37258848
Alignment:
| Q |
1 |
ccaaacggttggttatggaaatcaccttccacgaccaacggtggatgtggaacgaggtccattccgatggaatcaacgacgttgattcgtcgtagagctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37258625 |
ccaaacggttggttatggaaatcaccttccacgaccaacggtggatgtggaacgaggtccattccgatggaatcaacgacgttgattcgtcgtagagctt |
37258724 |
T |
|
| Q |
101 |
cgacttcttgtccaacacgtgcaccaatacataatgctttggatgtttcttggaggagattcttggtcttgagttcggagaagaatttggcgaaaactgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37258725 |
cgacttcttgtccaacacgtgcaccaatacataatgctttggatgtttcttggaggagattcttggtcttgagttcggagaagaatttggcgaaaactgg |
37258824 |
T |
|
| Q |
201 |
gatcttgcggttccagtcgcgtgt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37258825 |
gatcttgcggttccagtcgcgtgt |
37258848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University