View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_low_97 (Length: 223)
Name: NF7550_low_97
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_low_97 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 9446787 - 9446582
Alignment:
| Q |
1 |
tttttattgaattttagtttgccatattgtgaatgtaacttgtgtgaaagctgagaaaattcaaccaaaacttggatatgattttgatgtaagnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9446787 |
tttttattgaattttagtttgccatattgtgaatgtaacttgtgtgaaagctgagaaaattcaaccaaaacttggatatgattttgatgtaagaaaaaaa |
9446688 |
T |
 |
| Q |
101 |
ntttataaaaatgattcattctctatttggattatcttttataacaggactcttggacataagagtatccacatacttcctcattcaacatgttttttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9446687 |
aattataaaaatgattcattctctatttggattatcttttataacaggactcttggacataagagtatgcacatacttcctcattcaacatgttttttcc |
9446588 |
T |
 |
| Q |
201 |
cttcat |
206 |
Q |
| |
|
|||||| |
|
|
| T |
9446587 |
cttcat |
9446582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University