View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7550_low_99 (Length: 214)
Name: NF7550_low_99
Description: NF7550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7550_low_99 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 29662579 - 29662778
Alignment:
| Q |
1 |
ggaatttctcaaagtgcagcttccttggaatgctattgtatttcaagaatctatgttgcctgactttcaagaatttctcaaaatgaagccacgcagtctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29662579 |
ggaatttctcaaagtgcagcttccttggaatgctattgtatttcaagaatctatgttgcctgactttcaagaatttctcaaaatgaagccacgcagtctc |
29662678 |
T |
|
| Q |
101 |
atactccaacgagcaatcctcatttgcccgctaagcgacttcgctgcaaaaaaggtgacaaaagatatggggtattttcttgtggcgacaacactggata |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29662679 |
atactccaactagcaatcctcatttgcccgctaagcgacttcgctgcaaaaaaggtgacaaaagatatggggtattttcttgtggcgacaacactggata |
29662778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 84 - 200
Target Start/End: Complemental strand, 33201816 - 33201700
Alignment:
| Q |
84 |
tgaagccacgcagtctcatactccaacgagcaatcctcatttgcccgctaagcgacttcgctgcaaaaaaggtgacaaaagatatggggtattttcttgt |
183 |
Q |
| |
|
|||||||| |||||||||| || ||||| ||||||||||| | | ||||||| |||||||||||||||| ||||||||| ||||| || ||||||| |
|
|
| T |
33201816 |
tgaagccaggcagtctcatgcttcaacgggcaatcctcatccggcttttaagcgatttcgctgcaaaaaaggcgacaaaagacatgggatactttcttgc |
33201717 |
T |
|
| Q |
184 |
ggcgacaacactggata |
200 |
Q |
| |
|
|| ||| |||||||||| |
|
|
| T |
33201716 |
ggtgactacactggata |
33201700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 36 - 82
Target Start/End: Original strand, 29662545 - 29662591
Alignment:
| Q |
36 |
ttgtatttcaagaatctatgttgcctgactttcaagaatttctcaaa |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29662545 |
ttgtatttcaagaatctatgttgcctgactttcaggaatttctcaaa |
29662591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University