View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7551_high_30 (Length: 211)

Name: NF7551_high_30
Description: NF7551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7551_high_30
NF7551_high_30
[»] chr6 (1 HSPs)
chr6 (28-194)||(14736654-14736817)
[»] scaffold0665 (1 HSPs)
scaffold0665 (132-194)||(8541-8602)


Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 28 - 194
Target Start/End: Original strand, 14736654 - 14736817
Alignment:
28 tttagttgggaatttcgaaaaattttcaggattaataaattatgttcaagatattcagacaattttagatactcaggcatgttggtgcagtggtttgaca 127  Q
    ||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
14736654 tttagttgggaatttcgaaaagttt-caggattaataaattatgttgaagatattcagacaattttagatactcaggcatgttggtgcagtggtttgaca 14736752  T
128 gttcgacatgtacaattatgatagagcggcatgatgtgcttcacgttttcagctaaggaggtatatt 194  Q
    ||||||||||||||||||||||  ||| ||||||||||||||||||||||||||||| |||||||||    
14736753 gttcgacatgtacaattatgat--agcagcatgatgtgcttcacgttttcagctaagaaggtatatt 14736817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0665 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0665
Description:

Target: scaffold0665; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 132 - 194
Target Start/End: Complemental strand, 8602 - 8541
Alignment:
132 gacatgtacaattatgatagagcggcatgatgtgcttc-acgttttcagctaaggaggtatatt 194  Q
    ||||||||||||||||||||  | |||||||||||||| ||||||||||||||| |||||||||    
8602 gacatgtacaattatgatag--cagcatgatgtgcttctacgttttcagctaagaaggtatatt 8541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University