View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7551_high_30 (Length: 211)
Name: NF7551_high_30
Description: NF7551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7551_high_30 |
 |  |
|
| [»] scaffold0665 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 28 - 194
Target Start/End: Original strand, 14736654 - 14736817
Alignment:
| Q |
28 |
tttagttgggaatttcgaaaaattttcaggattaataaattatgttcaagatattcagacaattttagatactcaggcatgttggtgcagtggtttgaca |
127 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14736654 |
tttagttgggaatttcgaaaagttt-caggattaataaattatgttgaagatattcagacaattttagatactcaggcatgttggtgcagtggtttgaca |
14736752 |
T |
 |
| Q |
128 |
gttcgacatgtacaattatgatagagcggcatgatgtgcttcacgttttcagctaaggaggtatatt |
194 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14736753 |
gttcgacatgtacaattatgat--agcagcatgatgtgcttcacgttttcagctaagaaggtatatt |
14736817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0665 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0665
Description:
Target: scaffold0665; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 132 - 194
Target Start/End: Complemental strand, 8602 - 8541
Alignment:
| Q |
132 |
gacatgtacaattatgatagagcggcatgatgtgcttc-acgttttcagctaaggaggtatatt |
194 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
8602 |
gacatgtacaattatgatag--cagcatgatgtgcttctacgttttcagctaagaaggtatatt |
8541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University