View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7551_high_4 (Length: 553)
Name: NF7551_high_4
Description: NF7551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7551_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-109; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 93 - 311
Target Start/End: Original strand, 54471552 - 54471767
Alignment:
| Q |
93 |
tctctctctttcaaaaataactaactaattagatccatgcaataagatgaacatgtgttattctaacatattttattattacaggtaggtttgagaatac |
192 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54471552 |
tctctctctttcaaaaataactaact---tagatccatgcaataagatgaacatgtgttatactaacatattttattattacaggtaggtttgagaatac |
54471648 |
T |
 |
| Q |
193 |
atgatcgatcggggtcaatatttgagggagctgagtgtgacttcttcagatcattctttataacaatgtcttctatttcccaagaatcttctccaggacc |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54471649 |
atgatcgatcggggtcaatatttgagggagctgagtgtgacttcttcagatcattctttataacaatgtcttctatttcccaagaatcttctccaggacc |
54471748 |
T |
 |
| Q |
293 |
agacgctcaaaattcgtct |
311 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
54471749 |
agacgctcaaaattcgtct |
54471767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 471 - 522
Target Start/End: Original strand, 54471927 - 54471978
Alignment:
| Q |
471 |
tctccgtctccgactccaccttctaacacttccccatctcaaccatcacaat |
522 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54471927 |
tctccgtctccgactccaccttctaacacttccccatctcaaccatcacaat |
54471978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 38 - 101
Target Start/End: Original strand, 54471483 - 54471546
Alignment:
| Q |
38 |
ccttttctctcacccttataaggtaacattacattacatta-tcccttcttcttaatctctctct |
101 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||| ||||| ||||||||||||||||||||||| |
|
|
| T |
54471483 |
ccttttctctcacc-ttataaggtaacattaaatttcattaatcccttcttcttaatctctctct |
54471546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University