View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7551_low_13 (Length: 341)
Name: NF7551_low_13
Description: NF7551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7551_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 32346276 - 32345950
Alignment:
| Q |
1 |
cacatttcatagataaattgttcctttactttgttagaatcaaaacatcaattgcgaggtattgtttcttaatcaacttggttcttacagtggtaccata |
100 |
Q |
| |
|
||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
32346276 |
cacattttatagacaatttgttcctttactttgttagaatcaaaacatcaattgcgaggtattgtttcttaaccaacttgattcttacagtggtaccata |
32346177 |
T |
 |
| Q |
101 |
atttcgtttatttctcttaagataacacaaaaataaaatgtatactttaggatgtctacgtcagccttgttgttccacctttacctcattgaacctcgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32346176 |
atttcgtttatttctcttaagataacacaaaaataaaatgtatactttaggatgtttacgtcagccttgttgttccacctttacctcattgaacctcgaa |
32346077 |
T |
 |
| Q |
201 |
acatcttttgccttcttgaatacttgcctccaactacactgagccttttaagtagctccataacttatcaccattacctcttcaacctctggattgatta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32346076 |
acatcttttgccttcttgaatacttgcctccaactacactgagccttttaagtagctccataacttatcaccataacctcttcaacctctggattgatta |
32345977 |
T |
 |
| Q |
301 |
atttatgtcctcttgaagatcttcttg |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32345976 |
atttatgtcctcttgaagatcttcttg |
32345950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University