View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7551_low_14 (Length: 331)
Name: NF7551_low_14
Description: NF7551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7551_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 9e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 3811161 - 3810982
Alignment:
| Q |
1 |
gtgaggttatgcatgtgctgaagatgtgtttcaatggaatatagctcattaatgtaattttcatggatattgataacttcaaccgataacaaaccctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811161 |
gtgaggttatgcatgtgctgaagatgtgtttcaatggaatatagctcattaatgtaattttcatggatattgataacttcaaccgataacaaaccctttt |
3811062 |
T |
 |
| Q |
101 |
aagagtaatgaatttgtggttaatcgtttaatttattgtctttattttctttttaagggtacctgttatgttccacattc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811061 |
aagagtaatgaatttgtggttaatcgtttaatttattgtttttattttctttttaagggtacctgttatgttccacattc |
3810982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 243 - 331
Target Start/End: Complemental strand, 3810919 - 3810831
Alignment:
| Q |
243 |
cttgattcttgaagcgcataaatcaaattggagtaacacttctgcaannnnnnnaaggtgaaaacaatatcattaataatgaaagtagc |
331 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810919 |
cttgattcttgaagcgtataaatcaaattggagtaacacttctgcaatttttttaaggtgaaaacaatatcattaataatgaaagtagc |
3810831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University