View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7551_low_16 (Length: 310)
Name: NF7551_low_16
Description: NF7551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7551_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 88 - 293
Target Start/End: Original strand, 36155989 - 36156194
Alignment:
| Q |
88 |
aaagatagaatcgtttctagccttctaaatcaaccaaagaactgaatgtcaaatcaagagcaaatcttgcttcaacttccgtatgaaagtaagagaagaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36155989 |
aaagatagaatcgtttctagccttctaaatcaaccaaagaactgaatgtcaaatcaagagcaaatcttgcttcaacttccgtatgaaagtaagagaagaa |
36156088 |
T |
 |
| Q |
188 |
aaactattcaagcaaaatgaaaaggtttcccggaaccaccgaaaccaccccaagccacttaaaaacatctcaccaaattgctcccgcaatattacatttt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36156089 |
aaactattcaagcaaaatgaaaaggtttcccggaaccaccgaaaccactccaagccacttaaaaacatctcaccaaattgctcccgcaatattacatttt |
36156188 |
T |
 |
| Q |
288 |
gcaaat |
293 |
Q |
| |
|
|||||| |
|
|
| T |
36156189 |
gcaaat |
36156194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 44 - 86
Target Start/End: Original strand, 36155919 - 36155961
Alignment:
| Q |
44 |
taaaccaaccccatgagagatgcttaatagtgaatatcacctc |
86 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36155919 |
taaaccaaccccatgagagatgcttaatggtgaatatcacctc |
36155961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University