View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7551_low_21 (Length: 267)
Name: NF7551_low_21
Description: NF7551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7551_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 255
Target Start/End: Original strand, 49336291 - 49336530
Alignment:
| Q |
16 |
atatcttggaactgtatggtttcgggatatgctaaagcagggaaaatggatcgggcttgttatttgtttcaacaaatgccggagagaaattttgcctctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49336291 |
atatcttggaactgtatggtttcgggatatgctaaagcagggaaaatggatcgggcttgttatttgtttcaacaaatgccggagagaaattttgcctctt |
49336390 |
T |
 |
| Q |
116 |
ggaacacaatgattactggttatgttgactgtggaagcattgtggaagcaagagaattatttgatgcaatgccaaggagaaatagtgtctctttgataac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49336391 |
ggaacacaatgattactggttatgttgactgtggaagcattgtggaagcaagagaattatttgatgcaatgccaaggagaaatagtgtctctttgataac |
49336490 |
T |
 |
| Q |
216 |
tatgattgccgggtattcgaagagtggggatgttgattct |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49336491 |
tatgattgccgggtattcgaagagtggggatgttcattct |
49336530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 142
Target Start/End: Complemental strand, 15066646 - 15066616
Alignment:
| Q |
112 |
tcttggaacacaatgattactggttatgttg |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15066646 |
tcttggaacacaatgattactggttatgttg |
15066616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University