View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7551_low_23 (Length: 255)
Name: NF7551_low_23
Description: NF7551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7551_low_23 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 47 - 255
Target Start/End: Original strand, 37306525 - 37306733
Alignment:
| Q |
47 |
ttccaccttttctctacacaaatgcgaccctagtaatttaggacctttagaaaaactggtgaggtaattgtataatttgagaggtatgcgttaaaatttt |
146 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37306525 |
ttccaccttttctctacacaaatgcaaccctagtaatttaggaccttcagaaaaactggtgaggtaattgtataatttgagaggtatgcgttaaaatttt |
37306624 |
T |
 |
| Q |
147 |
ttaaaagtactaaaaatttgtttagaagcccagttgtatgcatgggtcccggagcccacaacttcctttcactttttcaaagcccatatactctcctctt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37306625 |
gtaaaagtactaaaaatttgtttagaagcccagttgtatgcatgggtcccggagcccacaacttcctttcactttttcaaagcccatatactctcctctt |
37306724 |
T |
 |
| Q |
247 |
cagtttagg |
255 |
Q |
| |
|
||||||||| |
|
|
| T |
37306725 |
cagtttagg |
37306733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University