View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7551_low_26 (Length: 250)
Name: NF7551_low_26
Description: NF7551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7551_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 54 - 239
Target Start/End: Complemental strand, 30594948 - 30594761
Alignment:
| Q |
54 |
attattattaatgttgattgttcttcactaaaatctggccccatttgtgatcacttcactcaagtccaagatata--catagcaactagctagagaatca |
151 |
Q |
| |
|
|||| ||||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
30594948 |
attaatattaatgtcgattgttcttcactgaaatctgaccccatttgtgatcacttcactcaagtccaagatatatacatagcaactagctagggaatca |
30594849 |
T |
 |
| Q |
152 |
catgagacagattaataagacattttcttagattcaaatatctgttcaattcactgccactggcaaattagtcaaatcgatatttctt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
30594848 |
catgagacagattaataagacattttcttagattcaaatatctgttcaattcactgccactggaaaattagtcaaatcaatatttctt |
30594761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 62
Target Start/End: Original strand, 37427294 - 37427342
Alignment:
| Q |
14 |
tgcttaaaaagtgtccggaagtactcgttaacatttcccaattattatt |
62 |
Q |
| |
|
|||||||| |||||||||| | ||||||||||||||||| ||| ||||| |
|
|
| T |
37427294 |
tgcttaaagagtgtccggaggcactcgttaacatttccctattgttatt |
37427342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University