View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7551_low_28 (Length: 241)
Name: NF7551_low_28
Description: NF7551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7551_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 5 - 119
Target Start/End: Complemental strand, 31938147 - 31938033
Alignment:
| Q |
5 |
gctaagttcttgcattgtatcgggtttccactttgtatgtgttggtgttgcataatttggttttcacttgatgtctgcagcacccaatgttattttggat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31938147 |
gctaagttcttgcattgtatcgggtttccactttgtatgtgttggtgttgcataatttggttttcacttgatgtctgcagcacccaatgttattttggat |
31938048 |
T |
|
| Q |
105 |
agcagatttttgaat |
119 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31938047 |
agcagatttttgaat |
31938033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 39 - 115
Target Start/End: Original strand, 7387886 - 7387962
Alignment:
| Q |
39 |
gtatgtgttggtgttgcataatttggttttcacttgatgtctgcagcacccaatgttattttggatagcagattttt |
115 |
Q |
| |
|
|||||||||||||||||||||| | ||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7387886 |
gtatgtgttggtgttgcataatctagtttttgcttgatgtctgcagcacccaatgttactttggatagcagattttt |
7387962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 28 - 114
Target Start/End: Complemental strand, 5638287 - 5638201
Alignment:
| Q |
28 |
gtttccactttgtatgtgttggtgttgcataatttggttttcacttgatgtctgcagcacccaatgttattttggatagcagatttt |
114 |
Q |
| |
|
||||||||||||| | | ||||||||||||| |||||||| | ||||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
5638287 |
gtttccactttgttttttttggtgttgcatagtttggtttccgcttgatgtcagcagcacccaatattattatggatagcagatttt |
5638201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University