View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7551_low_32 (Length: 209)
Name: NF7551_low_32
Description: NF7551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7551_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 22048584 - 22048763
Alignment:
| Q |
15 |
aagaagtt-attcatatttcacaaaaatgtaagttcagttttgattgtaagagttagaaccttgtaaatggtcaataaacaatgaactatctaagtacac |
113 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||| | |||||||||||||||||||| |
|
|
| T |
22048584 |
aagaagttgattcatatttcacaaaaatgtaagttcagttttgattgcaagagttaaaacctcataaatggtcaatagataatgaactatctaagtacac |
22048683 |
T |
|
| Q |
114 |
tttaatcttaagaattgtcctcttcaaacatctttgacccttattccacgggtggaattgaatgcaccggcatcatggtg |
193 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22048684 |
tttaatcttaaaaattgtcctcttcaaacatctttgacccttattccacgggtggaattgaatgcaccggcatcatggtg |
22048763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University