View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7552_low_4 (Length: 404)
Name: NF7552_low_4
Description: NF7552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7552_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 23 - 334
Target Start/End: Complemental strand, 29607215 - 29606892
Alignment:
| Q |
23 |
agtattatcatcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgcgtgatgtttctta |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607215 |
agtattatcatcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgcgtgatgtttctta |
29607116 |
T |
|
| Q |
123 |
tgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgct------------ggtgtgt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29607115 |
tgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgctggtgctgatgatggtgtgt |
29607016 |
T |
|
| Q |
211 |
ctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgtgtaggtgctggtgc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607015 |
ctattgcaggtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgtgtaggtgctggtgc |
29606916 |
T |
|
| Q |
311 |
cggtgtttctttgtctggcgcggg |
334 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
29606915 |
cggtgtttctttgtctggtgcggg |
29606892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 285 - 323
Target Start/End: Complemental strand, 29606881 - 29606843
Alignment:
| Q |
285 |
ttctttttgtgtgtaggtgctggtgccggtgtttctttg |
323 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
29606881 |
ttctttttgtgtgtaggtgctggtgctggtgcttctttg |
29606843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University