View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7552_low_5 (Length: 292)
Name: NF7552_low_5
Description: NF7552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7552_low_5 |
 | |
|
| [»] scaffold0256 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0256 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: scaffold0256
Description:
Target: scaffold0256; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 13 - 167
Target Start/End: Complemental strand, 10874 - 10720
Alignment:
| Q |
13 |
gttcaagttgactgagaaattatctatcctttcagaatcggttggatctcaccaccgctccttcaggttgcagaggtcaagacatctcctattctcagag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||| ||| |||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
10874 |
gttcaagttgactgagaaattatctatccttgcagagtcggttggatcttaccgccgctccttcaggtggcagaggtcaagacatgtcctattctcagac |
10775 |
T |
|
| Q |
113 |
gcttacgggagtttgtgctttactttgcatttacttcacatactcactatcatca |
167 |
Q |
| |
|
|||||||||| ||||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
10774 |
gcttacgggattttgtgcttaacattgcatttgcttcacatactcactatcatca |
10720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 67 - 164
Target Start/End: Original strand, 16572926 - 16573027
Alignment:
| Q |
67 |
ccgctccttcaggttgcagaggtcaagacatctcctattctcagaggcttacgggagtttgtgctttact----ttgcatttacttcacatactcactat |
162 |
Q |
| |
|
|||||||||||||| |||| || ||||||| ||||||||||| | |||| |||||||||||||| ||| ||||||||||||| |||||||| ||| |
|
|
| T |
16572926 |
ccgctccttcaggtggcaggcgtgaagacatgtcctattctcaaaagcttgggggagtttgtgcttaactaatgttgcatttacttctcatactcattat |
16573025 |
T |
|
| Q |
163 |
ca |
164 |
Q |
| |
|
|| |
|
|
| T |
16573026 |
ca |
16573027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University