View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7552_low_6 (Length: 284)
Name: NF7552_low_6
Description: NF7552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7552_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 39072321 - 39072574
Alignment:
| Q |
1 |
ttagataattgattctgaatgacacacaaagagccaataacttttgttgcatactgaacttgacctggacaaacacatcagcaactaaagttatcaattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39072321 |
ttagataattgattctgaatgacacacaaagagccaataacttttgctgcatactgaacttgacctggacaaacacatcagcaactaaagttatcaattg |
39072420 |
T |
 |
| Q |
101 |
caggctttgagagaaaaaattaacaatgtcaaattttgtttattatcgggtacaacaattacctatttcattgacaaagtagcatagcag-cagacagca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39072421 |
caggctttgagagaaaaaattaacaatgtcaaattttgtttattatc-ggtacaacaattacctatttcattgacaaagtagcatagcagtcagacagca |
39072519 |
T |
 |
| Q |
200 |
ggactcattacaaattgcggaatacctctttgtaaatgacatttgatgtagtatt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39072520 |
ggactcattacaaattgcggaatacctctttgtaaatgacatttgatgtagtatt |
39072574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University