View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7552_low_7 (Length: 282)
Name: NF7552_low_7
Description: NF7552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7552_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 29 - 269
Target Start/End: Complemental strand, 15702814 - 15702574
Alignment:
| Q |
29 |
gatggagaggaagtagtgaaaatatcagagaaataagaggttaagagtctttctagatggtcatcacctttccaccacactccgtcgacatctttcagtt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15702814 |
gatggagaggaagtagtgaaaatatcagagaaataagaggttaagagtctttctagatggtcatcacctttccaccacactccgaagacatctttcagtt |
15702715 |
T |
 |
| Q |
129 |
tcttaattgcatttgctttcctcctctggtcggccttgctatggaaaatttttgtatttctatcaccatccttcaaccatactgccatacttctctgcct |
228 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||| |
|
|
| T |
15702714 |
tcttaattgcatttgttttcctcctctggtcggccttgctatggaaaatttttgtatttctatccccatccttcaaccatactgccctactcctctgcct |
15702615 |
T |
 |
| Q |
229 |
ccacaaaacctcatctgttctcaacaggttgtctctctgct |
269 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15702614 |
ccacaaaaccttatctgttctcaacaggttgtctctctgct |
15702574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 169 - 201
Target Start/End: Complemental strand, 23378379 - 23378347
Alignment:
| Q |
169 |
atggaaaatttttgtatttctatcaccatcctt |
201 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
23378379 |
atggaaattttttgtatttctatcaccatcctt |
23378347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University