View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7552_low_8 (Length: 264)
Name: NF7552_low_8
Description: NF7552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7552_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 4 - 217
Target Start/End: Complemental strand, 39072261 - 39072048
Alignment:
| Q |
4 |
taaggataataggcagattgcatattcaagcatgtcaatgttagtgattaattaggtatgttgctgtagacaccgttacctctaattggatttccctttg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39072261 |
taaggataataggcagattgcatattcaagcatgtcaatgttactgattaattaggtatgttgctgtagacaccgttacctctaattggatttccctttg |
39072162 |
T |
|
| Q |
104 |
tattgcagatgaattggaaactaattgacaggacttttatgccactgttgttacaagacaaatcccacagttatgaaattgctatctgtttcatggcttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39072161 |
tattgcagatgaattggaaactaattgacaggacttttatgccactgttgttacaagacaaatcccacagttatgaaattgctatctgtttcatggcttt |
39072062 |
T |
|
| Q |
204 |
gaaaatgtaatgtg |
217 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39072061 |
gaaaatgtaatgtg |
39072048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 216 - 249
Target Start/End: Complemental strand, 39072029 - 39071996
Alignment:
| Q |
216 |
tgaaagtgtatgtttcatccgttaagaatttcat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39072029 |
tgaaagtgtatgtttcatccgttaagaatttcat |
39071996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 210
Target Start/End: Original strand, 23822737 - 23822843
Alignment:
| Q |
105 |
attgcagatgaattggaaactaattgacaggacttttatgccactgttgttacaagacaaatcccacagt-tatgaaattgctatctgtttcatggcttt |
203 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||| |||| | ||||||||||||||| ||||||| | |||| | |||| ||||||||||||| || |
|
|
| T |
23822737 |
attgcaggtgaattggaaactaattaacaggactttcatgctattgttgttacaagacagttcccacaatatatgtatttgcaatctgtttcatggtatt |
23822836 |
T |
|
| Q |
204 |
gaaaatg |
210 |
Q |
| |
|
||||||| |
|
|
| T |
23822837 |
gaaaatg |
23822843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 105 - 210
Target Start/End: Complemental strand, 40170890 - 40170784
Alignment:
| Q |
105 |
attgcagatgaattggaaactaattgacaggacttttatgccactgttgttacaagacaaatcccacagt-tatgaaattgctatctgtttcatggcttt |
203 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||| |||| | ||||||||||||||| ||||||| | |||| | ||| ||||||||||||| || |
|
|
| T |
40170890 |
attgcaggtgaattggaaactaattaacaggactttcatgctattgttgttacaagacagttcccacaatatatgtatttgtaatctgtttcatggtatt |
40170791 |
T |
|
| Q |
204 |
gaaaatg |
210 |
Q |
| |
|
||||||| |
|
|
| T |
40170790 |
gaaaatg |
40170784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University