View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7556_high_6 (Length: 222)

Name: NF7556_high_6
Description: NF7556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7556_high_6
NF7556_high_6
[»] chr7 (1 HSPs)
chr7 (10-205)||(10703462-10703657)


Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 205
Target Start/End: Complemental strand, 10703657 - 10703462
Alignment:
10 aagaatatatatgtaatcaatgaatttagcagtacgtggatagaaatgatgcaagtaatggaaagtataagattataaacaaaaggagacaaaagaatat 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
10703657 aagaatatatatgtaatcaatgaatttagcagtacgtggatagaaatgatgcaagtaatggaaagtataagattttaaacaaaaggagacaaaagaatat 10703558  T
110 taactagtatgcatggtaaagttaaggcacaaaatagaggctactactgagaccattgatatcctacgttgacaaacaccattagcatggaaaaag 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10703557 taactagtatgcatggtaaagttaaggcacaaaatagaggctactactgagaccattgatatcctacgttgacaaacaccattagcatggaaaaag 10703462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University