View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7558_low_13 (Length: 276)
Name: NF7558_low_13
Description: NF7558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7558_low_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 7 - 276
Target Start/End: Original strand, 44336947 - 44337216
Alignment:
| Q |
7 |
tcgaagaatatgatattccttatgatgttttgtggcttgatattgaacatactgacgggaagaggtattttacttgggatagagttcttttccctaatcc |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44336947 |
tcgatgaatatgatattccttatgatgttttgtggcttgatattgaacatactgacgggaagaggtattttacttgggatagagttcttttccctaatcc |
44337046 |
T |
 |
| Q |
107 |
tgaggagatgcagaagaaattggatggtaagggaaggcgcatggttaccatcgtggatcctcatattaagagagatgagaattttcatctgcacaaggag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44337047 |
tgaggagatgcagaagaaattggatggtaagggaaggcgcatggttaccatcgtggatcctcatattaagagagatgagaattttcatctgcataaggag |
44337146 |
T |
 |
| Q |
207 |
gcgtccgagaaagggtattacactaaggattccagtgggaatgattttgatggttggtgctggcctggtt |
276 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44337147 |
gcgtcagagaaagggtattacactaaggattccagtgggaatgattttgatggttggtgctggcctggtt |
44337216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University