View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7558_low_19 (Length: 210)
Name: NF7558_low_19
Description: NF7558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7558_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 192
Target Start/End: Original strand, 29525653 - 29525825
Alignment:
| Q |
20 |
ataagaccagagattgttaacaaagttcagataattgttttcccacatccctgagatatataattgagcttttacacatctagagcaccatcattgattc |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29525653 |
ataagaccagagattgttaacaaaattcagataattgttttcccacatccctgagatatataattgagtttttacacatctagagcaccatcattgattc |
29525752 |
T |
 |
| Q |
120 |
tcctttaagaatcagtatgaatccctcaatcaatactcttaccatttcttgctgttaatcttatctgattctt |
192 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29525753 |
tcctttaagaatcactatgaatccctcaatcaatactcttaccatttcttgcggttaatcttatctgattctt |
29525825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University