View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7559_high_20 (Length: 261)
Name: NF7559_high_20
Description: NF7559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7559_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 44567827 - 44568061
Alignment:
| Q |
18 |
gtatgcctctatgttttgtcacgttcctttactattgtgattctaatgcttgattttgatgttgtctaattctgtgattgaaatttgttaatttactata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44567827 |
gtatgcctctatgttttgtcacgttcctttactattgtgattctaatgcttgattttgatgttgtctaattctgtgattgaaatttgttaatttactata |
44567926 |
T |
 |
| Q |
118 |
acactccttagttccattctcaactagaaatatatgtgttgtaggttgatgtcagttttgttttatttttcctttctaaaaaacacttgtgaatatgttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44567927 |
acactccttagttccattctcaactagaaatatatgtgttgtaggttgatgtcagttttgttttatttttcctttctaaaaaacacttgtgaatatgttc |
44568026 |
T |
 |
| Q |
218 |
cttttgcagttgaactatgtactgaacatgatatt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44568027 |
cttttgcagttgaactatgtactgaacatgatatt |
44568061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 34 - 106
Target Start/End: Complemental strand, 36028968 - 36028897
Alignment:
| Q |
34 |
tgtcacgttcctttactattgtgattctaatgcttgattttgatgttgtctaattctgtgattgaaatttgtt |
106 |
Q |
| |
|
||||| ||||||||||||||| || | | |||||||||||||||| | | ||||||| |||||||||||||| |
|
|
| T |
36028968 |
tgtcatgttcctttactattgcgaatattatgcttgattttgatggtat-aaattctgcgattgaaatttgtt |
36028897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University