View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7559_low_23 (Length: 252)
Name: NF7559_low_23
Description: NF7559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7559_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 45758879 - 45758633
Alignment:
| Q |
1 |
caatttagagtttagagcacaaagtttaactcttggggttgcttaaatatctgcatttgatttctcatgccaatgatccttaccgaaactcttaaaacga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
45758879 |
caatttagagtttagagcacaaagtttaactcttgaggttgcttaaatatctgcatttgatttctcatgccaatgatccttacccaaactcttaaaatga |
45758780 |
T |
 |
| Q |
101 |
tgaaaaaagatcaaaataaatcatgactcactttt-----ttttaataaagtacactaaattgttcagtcttcacaaaag--nnnnnnnnnnnnnnnnaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
45758779 |
tgaaaaaagatcaaaataaatcatgactcactttttttttttttaatgaagtacactaaattgttcagtcttcacaaaagttttttttttttttttttat |
45758680 |
T |
 |
| Q |
194 |
gtaaccttcacaaaaaatttcttggtcatatttctcaaccatatatt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45758679 |
gtaaccttcacaaaaaatttcttggtcatatttctcaaccatatatt |
45758633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University