View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7560_low_5 (Length: 239)
Name: NF7560_low_5
Description: NF7560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7560_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 40957036 - 40956814
Alignment:
| Q |
1 |
ttcattcaccaatgcataacagcatacccatatgatgagtaaattcatcatataatatctaagcagaaatcaagtgtgatagcatnnnnnnn-tgggttg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40957036 |
ttcattcaccaatgcataacagcatacccatatgatgagtaaattcatcatataatatctaagcagaaatcaagtgtgatagcataaaaaaaatgggttg |
40956937 |
T |
 |
| Q |
100 |
catgtgtaaatagtatttgacaagaaattcaccttaataatggccacatacgccttttcatctttaccatcaggctcaagaagcacagtatcctcctaca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40956936 |
catgtgtaaatagtatttgacaagaaattcaccttgataatggccacatacgccttttcatctttaccatcaggctcaagaagcacagtatcctcctaca |
40956837 |
T |
 |
| Q |
200 |
gaaaaacaatgagacgccaaaaa |
222 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
40956836 |
gaaaaacaatgtgacgccaaaaa |
40956814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 110 - 203
Target Start/End: Complemental strand, 40944093 - 40944000
Alignment:
| Q |
110 |
tagtatttgacaagaaattcaccttaataatggccacatacgccttttcatctttaccatcaggctcaagaagcacagtatcctcctacagaaa |
203 |
Q |
| |
|
|||||||| | ||| |||| ||||| ||||| || ||||||| ||||| ||||||| | || ||| |||||||||||| ||||||| |||||| |
|
|
| T |
40944093 |
tagtatttaagaaggaattgaccttgataattgcgacatacggcttttgatctttaacctcgggcacaagaagcacagggtcctcctgcagaaa |
40944000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University