View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7562_high_3 (Length: 403)
Name: NF7562_high_3
Description: NF7562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7562_high_3 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 6 - 403
Target Start/End: Complemental strand, 36946529 - 36946136
Alignment:
| Q |
6 |
agctaaagttttaagagctgctaaaaattggtggggttatggacttatatggtctggagcttgtttttgcaatagtaacagtttcttcnnnnnnnaccta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36946529 |
agctaaagttttaagagctgctaaaaattggtggggttatggacttat--ggtctggagcttgtttttgcaatagtaacagtttcttctttttttaccta |
36946432 |
T |
 |
| Q |
106 |
gattcttgcttttgttttagcatggtattattggtgtttcagtagtcttggcttgtttggttttgtgaactgttattagtctacattgatttggggtgga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36946431 |
gattcttgcttttgttttagcatggtattattggtgtttcagtagtcttggcttgtttggttttgtgaactgttattagtctacattgatttggggtgga |
36946332 |
T |
 |
| Q |
206 |
tttgnnnnnnnngtgttttctttgtatctttgtcttattagttttggtggattaacctggttttatcatcttctagacatgtcttaggcatgtgagccat |
305 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36946331 |
tttgttttttttgtgttttctttgtatctttgtcttattagttttggtggattaacctggttttatcatcttctagacatgtcttaagcatgtgagccat |
36946232 |
T |
 |
| Q |
306 |
gcttgtatggttacattgatttggacggatcatttaagcatatacacatnnnnnnnnnnttacatgtctatcaaaaatataattgattcagctaactt |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36946231 |
gcttgtatggttacattgatttggacggatcatttaagcatatacacat--aaaaaaaattacatgtctatcaaaaatataattgattcagctaactt |
36946136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University