View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7566_high_21 (Length: 304)
Name: NF7566_high_21
Description: NF7566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7566_high_21 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 4885044 - 4885346
Alignment:
| Q |
1 |
gttaccgttacttctactgttgtttgttaatattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtgattattttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885044 |
gttaccgttacttctactgttgtttgttaatattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtgattattttta |
4885143 |
T |
|
| Q |
101 |
tccggtggtggcggtgtagggagaggcatgaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttaggaacaactccgc |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4885144 |
tccggtggtggcggcgtagggagaggcatgaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttaggaacaacaccgc |
4885243 |
T |
|
| Q |
201 |
catcttgtgttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgatttcttctcactc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4885244 |
catcttgtgttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgatttcttct-actc |
4885342 |
T |
|
| Q |
301 |
gacc |
304 |
Q |
| |
|
|||| |
|
|
| T |
4885343 |
gacc |
4885346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University