View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7566_high_36 (Length: 212)

Name: NF7566_high_36
Description: NF7566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7566_high_36
NF7566_high_36
[»] chr5 (1 HSPs)
chr5 (17-194)||(2271555-2271732)


Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 2271732 - 2271555
Alignment:
17 tatccaccaaaatactaaccaatggaccacttcgtcactgcatattcatcatcataattaatgactttcaaaacaaggatttaattagtacaatacattt 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
2271732 tatccaccaaaatactaaccaatggaccacttcgtcactgcatattcatcatcataattaatgactttcaaaacaaggatttaatcagtacaatacattt 2271633  T
117 gttttatagctaaattttgatttttcttttctatcatctatctgataaaagtaataaaattttgttttctgtactaat 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2271632 gttttatagctaaattttgatttttcttttctatcatctatctgataaaagtaataaaattttgttttctgtactaat 2271555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University