View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7566_low_23 (Length: 260)
Name: NF7566_low_23
Description: NF7566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7566_low_23 |
 |  |
|
| [»] chr8 (6 HSPs) |
 |  |
|
| [»] scaffold0785 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 260
Target Start/End: Complemental strand, 25565235 - 25564992
Alignment:
| Q |
17 |
ataatctagggatgtttacggtacagaccaacccgttgactcaactggaagcattttgtcaactgggtttcaaattctattttatcacatttatacaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25565235 |
ataatctagggatgtttacggtacagaccaacccgttgactcaactggaagcattttgtcaactgggtttcaaattctattttatcacatttatacaaaa |
25565136 |
T |
 |
| Q |
117 |
ctcaaccttgctcgagcagtcttttagagtgatcagtctttgttgtcttataaacnnnnnnnngttgttgtaattttctgccattcattgtannnnnnna |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
25565135 |
ctcaaccttgctcgagcagtcttttagagtggtcagtctttgttgtcttataaacttttttttgttgttgtaattttctgccattcattgtattttttta |
25565036 |
T |
 |
| Q |
217 |
gatgtatctcttgtataaagatgttttatcagagagatacagtt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25565035 |
gatgtatctcttgtataaagatgttttatcagagagatacagtt |
25564992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 84 - 141
Target Start/End: Complemental strand, 25671030 - 25670973
Alignment:
| Q |
84 |
tttcaaattctattttatcacatttatacaaaactcaaccttgctcgagcagtctttt |
141 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25671030 |
tttcaaattatattttatcacatttatgcaaaactcaaccttgctcgagcagtctttt |
25670973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 85 - 141
Target Start/End: Complemental strand, 25333078 - 25333022
Alignment:
| Q |
85 |
ttcaaattctattttatcacatttatacaaaactcaaccttgctcgagcagtctttt |
141 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25333078 |
ttcaaattctactttatcacatttatgcaaaactcaaccttgctcgagcagtctttt |
25333022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 85 - 140
Target Start/End: Complemental strand, 25473222 - 25473167
Alignment:
| Q |
85 |
ttcaaattctattttatcacatttatacaaaactcaaccttgctcgagcagtcttt |
140 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25473222 |
ttcaaattctactttatcacatttatgcaaaactcaaccttgctcgagcagtcttt |
25473167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 74 - 126
Target Start/End: Complemental strand, 25830627 - 25830575
Alignment:
| Q |
74 |
gtcaactgggtttcaaattctattttatcacatttatacaaaactcaaccttg |
126 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25830627 |
gtcaagtgggtttcaaattctattttatcacatttatgcaaaactcaaccttg |
25830575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 75
Target Start/End: Complemental strand, 25831265 - 25831207
Alignment:
| Q |
17 |
ataatctagggatgtttacggtacagaccaacccgttgactcaactggaagcattttgt |
75 |
Q |
| |
|
|||||| |||| |||||||||||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
25831265 |
ataatccaggggtgtttacggtacaggccaacccgttgactcaacctgaagcgttttgt |
25831207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0785 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0785
Description:
Target: scaffold0785; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 74 - 146
Target Start/End: Original strand, 4045 - 4117
Alignment:
| Q |
74 |
gtcaactgggtttcaaattctattttatcacatttatacaaaactcaaccttgctcgagcagtcttttagagt |
146 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4045 |
gtcaagtgggtttcaaattctattttatcacatttatataaaactcaaccttgctcgagcagtcttttagagt |
4117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University