View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7566_low_30 (Length: 239)
Name: NF7566_low_30
Description: NF7566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7566_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 24567135 - 24567357
Alignment:
| Q |
1 |
agaggagttgatgatcttgtattccattttcctgtcattttatttgttcttgatgttaataaaaattgggagccacatgttcagttgtggatcaatttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24567135 |
agaggagttgatgatcttgtattccattttcctgtcattttatttgttcttgatgttaataaaaattgggagccacatgttcagttgtggatcaatttca |
24567234 |
T |
|
| Q |
101 |
ccctccattcatctcaatatctagcacttcctaaataaaaagatcaatttcagacaatagaaaccttaatttaaggatataggatttatatttaacggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24567235 |
ccctccattcatctcaatatctagcacttcctaaataaaaagatcaatttcagataatagaaaccttaatttaaggatataggatttatatttaacggat |
24567334 |
T |
|
| Q |
201 |
tataccaagtattagcattttac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
24567335 |
tataccaagtattagcattttac |
24567357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 2931019 - 2931059
Alignment:
| Q |
8 |
ttgatgatcttgtattccattttcctgtcattttatttgtt |
48 |
Q |
| |
|
|||||||||||| ||||||||||| |||| ||||||||||| |
|
|
| T |
2931019 |
ttgatgatcttgcattccattttcttgtctttttatttgtt |
2931059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University