View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7566_low_36 (Length: 212)
Name: NF7566_low_36
Description: NF7566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7566_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 2271732 - 2271555
Alignment:
| Q |
17 |
tatccaccaaaatactaaccaatggaccacttcgtcactgcatattcatcatcataattaatgactttcaaaacaaggatttaattagtacaatacattt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2271732 |
tatccaccaaaatactaaccaatggaccacttcgtcactgcatattcatcatcataattaatgactttcaaaacaaggatttaatcagtacaatacattt |
2271633 |
T |
|
| Q |
117 |
gttttatagctaaattttgatttttcttttctatcatctatctgataaaagtaataaaattttgttttctgtactaat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2271632 |
gttttatagctaaattttgatttttcttttctatcatctatctgataaaagtaataaaattttgttttctgtactaat |
2271555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University