View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7568_high_9 (Length: 246)
Name: NF7568_high_9
Description: NF7568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7568_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 124
Target Start/End: Original strand, 17531283 - 17531396
Alignment:
| Q |
13 |
gtgagaagaaaacaatgtttatgta--atatagctataactatgtttgatttaaggaaaataaaattattcggatgttgcaaatgatatgtgtgatttta |
110 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17531283 |
gtgacaagaaaacaatgtttatgtataatatagctataactatgtttgatttaaggaaaataaaattattcggatgttgcaaatgatatgtgtgatttta |
17531382 |
T |
 |
| Q |
111 |
aggtgttaaaatag |
124 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
17531383 |
aggtgtgaaaatag |
17531396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 146 - 203
Target Start/End: Original strand, 17531384 - 17531440
Alignment:
| Q |
146 |
ggtgttaaaatagttttaatgtcaaacaaaagagacttcttatattaaaactttgatt |
203 |
Q |
| |
|
||||| ||||||||| || |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17531384 |
ggtgtgaaaatagttata-tgtcaaacaaaatagacttcttatattaaaactttgatt |
17531440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University