View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7568_low_9 (Length: 258)
Name: NF7568_low_9
Description: NF7568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7568_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 14609060 - 14608819
Alignment:
| Q |
13 |
aatatatactattataaaatttgaattaacgaaaaaattttgagacagtaaaattgatcatcaaatttgacgtttctaacctttaacgataaaattagag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14609060 |
aatatatactattataaaatttgaattaacgaaaaa-ttttgagacagtaaaattgatcatcaaatttgacgtctctaacctttaacgataaaattagag |
14608962 |
T |
 |
| Q |
113 |
acgaatttgacaattttttgt--------------agcttttgcaacttttctaataatgatatttgaaagaaaagaataaaaaatatcaatttcgacac |
198 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14608961 |
acgaatttgacaattttttgtctctaaatttttgtagcttttgcaacttttctaataatgatatttgaaagaaaagaataaaaaatatcaatttcgacac |
14608862 |
T |
 |
| Q |
199 |
acatatatacatgcatacctacactcacatggagtcacatcat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14608861 |
acatatatacatgcatacctacactcacatggagtcacatcat |
14608819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University