View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7569_high_16 (Length: 299)
Name: NF7569_high_16
Description: NF7569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7569_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 57; Significance: 8e-24; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 73 - 161
Target Start/End: Complemental strand, 4462135 - 4462047
Alignment:
| Q |
73 |
aaactaagttccctaattaaattcataacagaaatgataaaattccaatattgaacccactaatgtattgcaaaataattatcactagt |
161 |
Q |
| |
|
|||| |||| ||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
4462135 |
aaacaaagtaccctaatgaaattcatagaagaaatgataaaattccaatattgaacccgctgatgtattgcaaaataatcatcactagt |
4462047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 235 - 290
Target Start/End: Complemental strand, 4461464 - 4461410
Alignment:
| Q |
235 |
caaaatatcacaagactatttccttcttatttcaggttgtctagaatatcaaactc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||| ||||||||| |
|
|
| T |
4461464 |
caaaatatcacaagactatttccttctta-ttaaggttgtctagaagatcaaactc |
4461410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 297
Target Start/End: Complemental strand, 4444873 - 4444800
Alignment:
| Q |
223 |
tttacttgaatgcaaaatatcacaagactatttccttcttatttcaggttgtctagaatatcaaactcgtgaata |
297 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| |||||||||| || |||| | ||| ||||||||| |||||| |
|
|
| T |
4444873 |
tttacttgaatgcaaa-taccacaagactattttcttcttattttagattgtatggaagatcaaactcatgaata |
4444800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 209
Target Start/End: Complemental strand, 4461669 - 4461624
Alignment:
| Q |
164 |
taaaaatgtacagaacaaacagagaaagaaacccgtaactgatcca |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| |||||| |
|
|
| T |
4461669 |
taaaaatgtacaaaacaaacagagaaagaaacccataaccgatcca |
4461624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University