View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7569_high_20 (Length: 244)
Name: NF7569_high_20
Description: NF7569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7569_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 43403444 - 43403228
Alignment:
| Q |
19 |
atgtcagtatacagaacaaaggtagctgatcattgccgtttgataaccatcacatggtgcaaaaacttgttgcttcatggactatcaatatcagtagaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43403444 |
atgtcagtatacagaacaaaggtagctgatcattgccgtttgataaccatcacatggtgcaaaaacttgttgcttcatggactatcaatatcagtagaag |
43403345 |
T |
 |
| Q |
119 |
gtccagaaggagaagcccaatatacctgcaaagttgaactaaagccatggtatttttggagaaaacaaggttcaaaacggtttatagttgatggaaacaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43403344 |
gtccagaaggagaagcccaatatacctgcaaagttgaactaaagccatggtatttttggagaaaacaaggttcaaaacggtttatagttgatggaaacaa |
43403245 |
T |
 |
| Q |
219 |
agctgttgacatattct |
235 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
43403244 |
agctgttgacattttct |
43403228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 34432514 - 34432333
Alignment:
| Q |
19 |
atgtcagtatacagaacaaaggtagctgatcattgccgtttgataaccatcacatggtgcaaaaacttgttgcttcatggactatcaatatcagtagaag |
118 |
Q |
| |
|
||||||||||||||||||||| |||||| ||| ||||||||||| || ||||||||||||||||||||| |||||||||| ||||| || |||| ||| |
|
|
| T |
34432514 |
atgtcagtatacagaacaaagttagctggtcactgccgtttgatcacaatcacatggtgcaaaaacttgatgcttcatggcttatcagtaacagtggaaa |
34432415 |
T |
 |
| Q |
119 |
gtccagaaggagaagcccaatatacctgcaaagttgaactaaagccatggtatttttggagaaaacaaggttcaaaacggtt |
200 |
Q |
| |
|
|| ||| ||| | ||||||| |||||| ||||| |||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
34432414 |
accctgaaaaggaaactcaatatagctgcaaggttgagctaaagccatggtacttttggaggaaacaaggttcaaaacggtt |
34432333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 98
Target Start/End: Original strand, 26100087 - 26100166
Alignment:
| Q |
19 |
atgtcagtatacagaacaaaggtagctgatcattgccgtttgataaccatcacatggtgcaaaaacttgttgcttcatgg |
98 |
Q |
| |
|
|||||||||||||||| || ||||| |||||| | |||||||| || ||||||| |||| |||||||| | |||||||| |
|
|
| T |
26100087 |
atgtcagtatacagaagaatggtagatgatcactctcgtttgattacaatcacatagtgcgaaaacttgcttcttcatgg |
26100166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University