View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7569_low_1 (Length: 773)
Name: NF7569_low_1
Description: NF7569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7569_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 8e-97; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 8e-97
Query Start/End: Original strand, 574 - 765
Target Start/End: Original strand, 16978772 - 16978963
Alignment:
| Q |
574 |
gagagagaaaaagtgttgtctaaggatgatgaagtttaatgttaggaaagtgatgtaatgaaatactataaaaacatggaaatagaaaaagaatcagaca |
673 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16978772 |
gagagagaaagagtgttgtctaaggatgatgaagtttaatgttaggaaagtgatgtaatgaaatactataaaaacatgtaaatagaaaaagaatcagaca |
16978871 |
T |
 |
| Q |
674 |
ttggtgtgtaacacaaatagagcaaagagaaagagagacgtgtaactggcgccaaactatatgaggaaaacatcacttatgaacaccaaact |
765 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16978872 |
ttggtgtgtaacacaaatagagcaaagagaaagagagacgtgtaactggcgccaaactatatgaggaaaacctcacttatgaacaccaaact |
16978963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 169; E-Value: 3e-90
Query Start/End: Original strand, 201 - 389
Target Start/End: Original strand, 16978411 - 16978599
Alignment:
| Q |
201 |
gaaataaccttaacattcttaggaagaacaaaagtttctctttttaccttcattctcttacaacgagaaacataatgatccaaacccatatcatcttcat |
300 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16978411 |
gaaataactttaacattcttaggaagaacaaaagtttctctttttaccttcattttcttacaacgagaaacatagtgatccaaacccatatcatcttcat |
16978510 |
T |
 |
| Q |
301 |
cactctttcttagccgcttcgatttcactggaagacagcggaacaatggaacattcttgcttcgagttctgcttgaaacactagccatt |
389 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16978511 |
cactctttcttagccgcttcgatttcagtggaagacaacggaacaatggaacattcttgcttcgagttctgcttgaaacactagccatt |
16978599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 294 - 389
Target Start/End: Original strand, 16969366 - 16969461
Alignment:
| Q |
294 |
tcttcatcactctttcttagccgcttcgatttcactggaagacagcggaacaatggaacattcttgcttcgagttctgcttgaaacactagccatt |
389 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||| | |||||||||||||| ||||| ||||||||||| |||| || ||||||| |
|
|
| T |
16969366 |
tcttcatcactctttcttcgccgcttcgatttcggaggaagacaaccaaacaatggaacatttttgctacgagttctgctagaaataccagccatt |
16969461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 441 - 473
Target Start/End: Original strand, 16978651 - 16978683
Alignment:
| Q |
441 |
acgttgttctttctctgttatatgttagtactt |
473 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16978651 |
acgttgttctttctctgttatatgttagtactt |
16978683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 342 - 388
Target Start/End: Complemental strand, 35262210 - 35262164
Alignment:
| Q |
342 |
aacaatggaacattcttgcttcgagttctgcttgaaacactagccat |
388 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
35262210 |
aacaacggaacattcttgctacgagttctgctagaaacaccagccat |
35262164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 159
Target Start/End: Complemental strand, 41345281 - 41345252
Alignment:
| Q |
130 |
tcatcatggtcgttgaaatttcaaaactta |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41345281 |
tcatcatggtcgttgaaatttcaaaactta |
41345252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University