View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7569_low_15 (Length: 311)
Name: NF7569_low_15
Description: NF7569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7569_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 2378425 - 2378724
Alignment:
| Q |
1 |
ctaagttcacgttgattagttgctatttagtagttgaatcgactccattttgatggttgaaggtaatgt---taatatattttccttattttatttctag |
97 |
Q |
| |
|
|||||| ||| |||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2378425 |
ctaagtgcactttgattagtttctatttagtagttgaatcaactccattttgatggttgaaggtaatgtatataatatattttccttattttatttctag |
2378524 |
T |
 |
| Q |
98 |
ccttcttttgataattaacataaattgatggatacattattcataaactattaaattcataacataacacgtctctctcaataatattatgtagggggta |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2378525 |
ccttcttttgataattaacataaattgatggatacattattcataaactattaaattcataacataacacgtctcgctcaataatattatgtagggggtg |
2378624 |
T |
 |
| Q |
198 |
atgttcgaacctcaaacacatcaaaaaactcataacataaaattgatcatttcacttgtgtgtacaccgattcattttaggactatcacttttgcgggcc |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2378625 |
atgttcgaacctcaaacacatcaaaaaactcataacataaaattaatcatttcacttgtgtgtacaccgattcattttacgactatcacttttgcgggcc |
2378724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University