View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7569_low_26 (Length: 203)
Name: NF7569_low_26
Description: NF7569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7569_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 49 - 187
Target Start/End: Original strand, 11434042 - 11434180
Alignment:
| Q |
49 |
ctcaaagactcgcttgttagattgagcttggccggaatctacaatgaaattgatattcatttgtgtatttgctaacacttcgaccttcaagttaatataa |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11434042 |
ctcaaagactcgcttgttagattgagcttggccggaatctacaatgaaattgatgttcatttgtgtatttgctaacacttcgaccttcaagttaatataa |
11434141 |
T |
 |
| Q |
149 |
ttttttaggtgagtgtgagatttaaaatagtgcatattt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11434142 |
ttttttaggtgagtgtgagatttaaaataatgcatattt |
11434180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 68 - 183
Target Start/End: Complemental strand, 11552043 - 11551932
Alignment:
| Q |
68 |
gattgagcttggccggaatctacaatgaaattgatattcatttgtgtatttgctaacacttcgaccttcaagttaatataattttttaggtgagtgtgag |
167 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||| | ||||||| ||||||||||||||||||||| ||||| |||| | ||||||||||| |
|
|
| T |
11552043 |
gattgagcttggtcggaatctacaatgaaattgatgttcgatggtgtatt----aacacttcgaccttcaagttagtataagttttcaagtgagtgtgag |
11551948 |
T |
 |
| Q |
168 |
atttaaaatagtgcat |
183 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
11551947 |
atttaaaataatgcat |
11551932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 149
Target Start/End: Original strand, 39394690 - 39394728
Alignment:
| Q |
111 |
gtgtatttgctaacacttcgaccttcaagttaatataat |
149 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
39394690 |
gtgtatttgctaacactttgacgttcaagttaatataat |
39394728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University