View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7570_low_7 (Length: 236)
Name: NF7570_low_7
Description: NF7570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7570_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 10 - 223
Target Start/End: Complemental strand, 31439010 - 31438797
Alignment:
| Q |
10 |
gatggacatcaggtggtgataaaaggtgagtgatagtgagatccgtggcgctggcatggatgaaatctacgccagcgtcattgcatgtgataaagatgtg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31439010 |
gatggacatcaggtggtgataaaaggtgagtgatagtgagatccgtggcgctggcatggatgaaatctacgccagagtcattgcatgtgataaagatgtg |
31438911 |
T |
 |
| Q |
110 |
accggcagagtcggtcacaaaacggccagcaagtggggggaagattgatagggttttagagagagaggttttaaggtgggggatgagtgtttgagaaggg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31438910 |
accggcagagtcggtcacaaaacggccagcaagtggggggaagattgatagggttttagagagagaggttttaaggtgggggacgagtgtttgagaaggg |
31438811 |
T |
 |
| Q |
210 |
agagatggtgatgt |
223 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
31438810 |
agagatggcgatgt |
31438797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University