View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7573_high_18 (Length: 242)
Name: NF7573_high_18
Description: NF7573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7573_high_18 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 12690447 - 12690688
Alignment:
| Q |
1 |
tttgatacttcaactactctccgaatatcataaaaaatataatatcgtgttcacacacaaaaaaccaataacatttgcaacattatttatggtctcttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12690447 |
tttgatacttcaactactctccgaatatcataaaaaatataatatcgtgttcacacacaaaaaaccaataacatttgcaacattatttatggtctcttta |
12690546 |
T |
|
| Q |
101 |
tcaataacatttcaactgcaatgtatttgatggggttgtgtagcatagcactctttcaatccaatcaatgttaacgtccatgtatgaagtaacgatcact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12690547 |
tcaataacatttcaactgcaatgtatttgatggggttgtgtagcgtagcactctttcaatccaatcaatgttaacgtccatgtatgaagtaacgatcact |
12690646 |
T |
|
| Q |
201 |
atgatgcatttttgcatgtactaaaagagtccatgtagacaa |
242 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12690647 |
atgatgcatttttgcatgtactgaaagagtccatgtagacaa |
12690688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University