View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7573_high_19 (Length: 241)
Name: NF7573_high_19
Description: NF7573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7573_high_19 |
 | |
|
| [»] scaffold0181 (1 HSPs) |
| | |
|
| [»] scaffold0171 (3 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 24939844 - 24940066
Alignment:
| Q |
1 |
gagctgttgactctaaccaatagcattataacaaggatgacaatgagaaaaacttttggttctaagaatgatatttgtgaagttaaggacattcggaaga |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24939844 |
gagctgttgactctatccaatagcattataacaaggatgacaatgagaaaaacttttggttctaagaatgatatttgtgaagttaaggacattcggaaga |
24939943 |
T |
|
| Q |
101 |
tggtgaaagacactgccgagcttgcagggaagtttaatgtgtcagattttatttggttttgtaagaatttggatttttatggaatgaataaaaggcttaa |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24939944 |
tggtgacagacactgccgagcttgcagggaagtttaatgtgtcggattttatttggttttgtaagaatttggatttttatggaatgaataaaaggcttaa |
24940043 |
T |
|
| Q |
201 |
aagaattagggacaggtttgaca |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
24940044 |
aagaattagggacaggtttgaca |
24940066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 25168463 - 25168685
Alignment:
| Q |
1 |
gagctgttgactctaaccaatagcattataacaaggatgacaatgagaaaaacttttggttctaagaatgatatttgtgaagttaaggacattcggaaga |
100 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||| |||||||||| ||||||||| |||||| ||||||||||| | || ||||| || ||| |||||| |
|
|
| T |
25168463 |
gagctattgactctcaccaatagcattataacaataatgacaatgaaaaaaactttcggttctgagaatgatattagcgatgttaaagagattaggaaga |
25168562 |
T |
|
| Q |
101 |
tggtgaaagacactgccgagcttgcagggaagtttaatgtgtcagattttatttggttttgtaagaatttggatttttatggaatgaataaaaggcttaa |
200 |
Q |
| |
|
|||||| ||| || || ||||||| ||||||| | |||||||| |||||||| ||||||| ||||||| | |||||||||||||||||||||| ||| || |
|
|
| T |
25168563 |
tggtgacagagaccgcagagcttgtagggaaggtgaatgtgtcggattttatctggttttttaagaatatagatttttatggaatgaataaaaagctgaa |
25168662 |
T |
|
| Q |
201 |
aagaattagggacaggtttgaca |
223 |
Q |
| |
|
||| ||| |||| |||||||||| |
|
|
| T |
25168663 |
aaggattcgggataggtttgaca |
25168685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0181 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0181
Description:
Target: scaffold0181; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 118 - 201
Target Start/End: Complemental strand, 11307 - 11224
Alignment:
| Q |
118 |
gagcttgcagggaagtttaatgtgtcagattttatttggttttgtaagaatttggatttttatggaatgaataaaaggcttaaa |
201 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||| |||| |||||||||||||| | ||||| |||||||||||||| |
|
|
| T |
11307 |
gagcttggagggacgtttaatgtgtcagattttatttgggtttgcaagaatttggatttacaaggaatacataaaaggcttaaa |
11224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 3)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 88 - 174
Target Start/End: Original strand, 18967 - 19053
Alignment:
| Q |
88 |
gacattcggaagatggtgaaagacactgccgagcttgcagggaagtttaatgtgtcagattttatttggttttgtaagaatttggat |
174 |
Q |
| |
|
|||||| ||||||||||| |||| | || |||||| |||||| ||||||| |||| |||||||||||||||| |||||||| |||| |
|
|
| T |
18967 |
gacattaggaagatggtgcaagatagtgtagagctttcagggaggtttaatttgtcggattttatttggttttttaagaattgggat |
19053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 24409 - 24464
Alignment:
| Q |
121 |
cttgcagggaagtttaatgtgtcagattttatttggttttgtaagaatttggattt |
176 |
Q |
| |
|
|||| |||| |||||||| |||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
24409 |
cttggagggcagtttaatttgtcggattttatttggttttttaagaattgggattt |
24464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 171
Target Start/End: Original strand, 10859 - 10909
Alignment:
| Q |
121 |
cttgcagggaagtttaatgtgtcagattttatttggttttgtaagaatttg |
171 |
Q |
| |
|
|||||||||||||||| | ||| ||| | |||||||||||||||||||||| |
|
|
| T |
10859 |
cttgcagggaagtttagtatgttagaatatatttggttttgtaagaatttg |
10909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University