View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7573_high_20 (Length: 241)
Name: NF7573_high_20
Description: NF7573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7573_high_20 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 116 - 241
Target Start/End: Original strand, 23616749 - 23616874
Alignment:
| Q |
116 |
ttagccctctatataaatcccgttttagtagagattaaccttacaataattaatttctgtaatttttcatgtcaaataaattagtttgtttatacataat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23616749 |
ttagccctctatataaatcccgttttagtagagattaacctttcaataattaatttctgtaatttttcatgtcaaataaattagttggtttatacataat |
23616848 |
T |
|
| Q |
216 |
tatgttttaatggcttctagtatttt |
241 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
23616849 |
tatgttttaatgccttctagtatttt |
23616874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 19 - 114
Target Start/End: Original strand, 23616606 - 23616701
Alignment:
| Q |
19 |
ctgcaaacatctatattgtggtaaaatatgggaatatgcagttaattccgttgaaactgcactttgaattgatgcaatctaaaaccttgtttttaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23616606 |
ctgcaaacatctatattgtggtaaaatatgggaatatgcagctaattcctttgaaactgcactttgaattgatgcaatctaaaaccttgtttttaa |
23616701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University