View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7573_low_14 (Length: 314)
Name: NF7573_low_14
Description: NF7573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7573_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 16 - 297
Target Start/End: Complemental strand, 49131286 - 49131006
Alignment:
| Q |
16 |
attgttatgtgctagagaattgcatgtgggattgaagctgtcattggcaatttgataaggtgaatattgtgggagaaaatggattagaagatcaaagttg |
115 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||| || | || ||||| |||||||||||||||||||||||| |
|
|
| T |
49131286 |
attgttatgtgttacagaattgcatgtgggattgaagctgtcatttacaatttgataaggcgattgttaagggaggaaatggattagaagatcaaagttg |
49131187 |
T |
|
| Q |
116 |
ttggtatttagttagcaaattgcatgtgatgagtccatgattgcacttgtttattcatttgagcttacgtggtacttacatggatatgtgtcggttgaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49131186 |
ttggtatttagttagcaaattgcatgtgatgagtccatgattgcacttgtttattcatttgagcttacgtggtacttacatggatatgtgtcggttgaaa |
49131087 |
T |
|
| Q |
216 |
taaaataataaatctgaatgtaatgtttgtcatggtaggcagttctagctgtacttggtactatcatagtatatgatatatc |
297 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49131086 |
t-aaataataaatctgaatgtaatgtttgtcatggtaggcagttctagctgtacttggtactatcttagtatatgatatatc |
49131006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University