View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7573_low_25 (Length: 241)
Name: NF7573_low_25
Description: NF7573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7573_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 7 - 224
Target Start/End: Original strand, 23592007 - 23592224
Alignment:
| Q |
7 |
agtttggtggtgaggaggttaaaggagtttagttcagtcttccgtgataaacgatgttggtggaaagggataatttaaggtattagggtttaagtgcttg |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23592007 |
agtttggaggtgaggaggttaaaggagtttagtttagtcttccgtggtaaacgatgttggtggaaagggataatttaaggtattagggtttaagtgcttg |
23592106 |
T |
|
| Q |
107 |
ttatggtgggtgaggggatttgtgtggttgcagaattttaataggattagagatgatgttggcatgtgtgagggtagttggttgctcgataacattgggt |
206 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23592107 |
ttatggtgggtgaggggatctgtgtggttgcagaattttaataggattagagatgatgttggcatgtgtgagggtagttggttgcttgataacattgggc |
23592206 |
T |
|
| Q |
207 |
gtgtggttggtgataggt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
23592207 |
gtgtggttggtgataggt |
23592224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University