View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7573_low_28 (Length: 232)
Name: NF7573_low_28
Description: NF7573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7573_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 24 - 196
Target Start/End: Original strand, 9864230 - 9864402
Alignment:
| Q |
24 |
ttgcattttctgacaaagccttattcacatcctcgaatcacttctgacatacttgtaagtttctatatcttaaatcgattttcattatatgattgtttat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9864230 |
ttgcattttctgacaaagccttattcacatcctcgaatcacttctgacatacttgtaagtttctatatcttaaatcgattttcattatatgattgtttat |
9864329 |
T |
 |
| Q |
124 |
gctgcatataattgtttcgagtttgagatctcagcatagtcgagacgagatctctttgtccgataatgatgtc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9864330 |
gctgcatataattgtttcgagtttgagatctcaacatagtcgagacgagatctctttgtccgataatgatgtc |
9864402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University