View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7573_low_29 (Length: 232)
Name: NF7573_low_29
Description: NF7573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7573_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 888438 - 888652
Alignment:
| Q |
1 |
cctgaatttccacatccaccaaccaaaactttcttccctctaacctcttcaccacttttatacaaactagtatgcctaatactccccccaaactcatcaa |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
888438 |
cctgaatttccacatccaacaaccaaaactttcttccctctaaactcttcaccacttttatacaaactagtatgcctaatactaccaacaaactcatcaa |
888537 |
T |
 |
| Q |
101 |
ctccttcaatctcgggtacaaccgcctcagcattctctccggttgcaacgatcaaccaccggcaaacaaattcggtgaccattcccgccttcccctcact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
888538 |
ctccttcaatctcgggtacaaccgcctcagcattctctccggttgcaacgatcaaccaccggcaaacaaattcggtgaccattcccgccttcccctcact |
888637 |
T |
 |
| Q |
201 |
tctcaccctccaaaa |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
888638 |
tctcaccctccaaaa |
888652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 4 - 173
Target Start/End: Complemental strand, 50667881 - 50667712
Alignment:
| Q |
4 |
gaatttccacatccaccaaccaaaactttcttccctctaacctcttcaccacttttatacaaactagtatgcctaatactccccccaaactcatcaactc |
103 |
Q |
| |
|
||||| ||||| ||| |||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| ||| || ||||| ||||| || | |
|
|
| T |
50667881 |
gaattaccacaaccaacaaccaaaactttcttccctctaaactcttcaccacttttatacaaacttgtatgccttataactcctccaaattcatctacgc |
50667782 |
T |
 |
| Q |
104 |
cttcaatctcgggtacaaccgcctcagcattctctccggttgcaacgatcaaccaccggcaaacaaattc |
173 |
Q |
| |
|
||||||| | || ||||| || || |||||||| ||||| || ||||||||||| || |||||| |||| |
|
|
| T |
50667781 |
cttcaatattaggcacaacagcttcggcattctcaccggtcgctacgatcaaccaacgacaaacatattc |
50667712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University