View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7573_low_30 (Length: 227)
Name: NF7573_low_30
Description: NF7573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7573_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 25 - 209
Target Start/End: Original strand, 45042776 - 45042962
Alignment:
| Q |
25 |
aagaataaaatatacttaattacatgttcctttgcatacaagacaccgtcacattgatgtaagtaaaaataatttgagaacnnnnnnnnn--ggaagttt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45042776 |
aagaataaaatatacttaattacatgttcctttgcatacaagacaccgtcacattgatgtaagtaaaaataatttgagaacaaaaaaaaaaaggaagttt |
45042875 |
T |
 |
| Q |
123 |
tcaatgattgccttcagaatcgactaactgaaaaatcaattaccgacacaaacggtatatgatttaatttcttgcatattttaccat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45042876 |
tcaatgattgccttcagaatcgactaactgaaaaatcaattaccgacacaaacggtatatgatttaatttcttgcatattttaccat |
45042962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University